Videos


todas las canciones de violeta



Rating Rating Rating Rating Rating 
Views: 2,078,337
Added: 2 years
Runtime: 14:59
Comments: 567

Tags for this video:  



Find more videos in the: "People"
Uploaded by: Jafiso Juegos y mas!
See more videos uploaded by Jafiso Juegos y mas!


Related Videos:

violeta show en vivo en palermo gratis Martina Stoessel @TiniStoessel #JuntadaTinista
Rating Rating Rating Rating Rating 
Views: 468578
donde se puede ver el recital de vileta que hizo en la ciudad de buenos ayres gratis en palermo #JuntadaTinista
Barbie Life in the Dreamhouse - Temporada 6 [Completa]
Rating Rating Rating Rating Rating
Views: 7633339
Barbie Life in the Dreamhouse | Temporada 6 Lista de los capítulos: Súper Escuadrón del Estilo Parte 1 Súper Escuadrón del Estilo Parte 2 Vestido...
Violetta: Peligrosamente Bellas (Episodio 40 - Temporada 2)
Rating Rating Rating Rating Rating 
Views: 25682966
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Esta canción seguramente está entre tus...
Violetta: Momento musical - Show final: Violetta canta con las chicas
Rating Rating Rating Rating Rating 
Views: 17838748
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ No te pierdas este clip del episodio 80 de...
Violetta: Dance Along de Juntos somos más - ¡Aprende la coreografía!
Rating Rating Rating Rating Rating 
Views: 8307997
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Aprende a bailar con el elenco de Violetta!...
Violetta: Video musical Junto a ti
Rating Rating Rating Rating Rating 
Views: 44154177
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Canta y baila esta canción de Violetta!...
Violetta 2: Diego e Vilu cantano "Yo soy asi" - (Episodio 20)
Rating Rating Rating Rating Rating 
Views: 52040090
Violetta - Seconda Stagione - Disney Channel - Martina Stoessel - Diego Dominguez Facebook: https://www.facebook.com/DisneyMundialVioletta All...
CD completo Violetta-primeiro e segundo CD
Rating Rating Rating Rating Rating 
Views: 6163322
Todas as músicas da 1° e 2° parte de violetta!! Facebook:http://www.facebook.com/maik.silva159?ref=tn_tnmn...
violetta vs grachi ¿quien es mejor?
Rating Rating Rating Rating Rating 
Views: 1277015
es mejor violetta
Violetta-Canciones Parte 1
Rating Rating Rating Rating Rating 
Views: 459382
Canciones (banda sonora de Violetta) PARTE 2- http://www.youtube.com/watch?v=6yU8J9-NXXI&feature=youtu.be PARTE 3-...
Frozen: Una Aventura Congelada - Libre Soy - Martina Stoessel
Rating Rating Rating Rating Rating 
Views: 77938318
Síguenos en Facebook: http://www.facebook.com/peliculasdisney Sitio Oficial: http://www.disneylatino.com/peliculas ¡Haz click en "Suscribirse"...
Violetta: Video Musical ¨Si Es Por Amor¨
Rating Rating Rating Rating Rating 
Views: 49732179
Mira más videos exclusivos de Violetta en: http://disneychannel.disneylatino.com/violetta ¿Has visto este momento musical de Violetta? Te...
014 SORPRESA ¿Violetta tiene una hermana, Jueves 27 de Marzo del 2014 Violetta ARGENTINA
Rating Rating Rating Rating Rating 
Views: 3124969
Violeta - Juntos Somos Mas ( Letra ) ( Video Oficial ) ( HD )
Rating Rating Rating Rating Rating 
Views: 4874235
Hola chicos este es el video oficial de la cancion juntos somos mas de la nueva serie violeta mas la letra en el video disfrutenlo y suscribanse :)
Violetta: Momento Musical - Violetta canta en el Restó Band
Rating Rating Rating Rating Rating 
Views: 4584996
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Canta y baila esta canción de Violetta!...
Violetta en Vivo: Venezuela
Rating Rating Rating Rating Rating 
Views: 2325894
Violetta en Vivo: Venezuela
Voy Por Ti - Leon - Violetta (Letra) Cancion Completa
Rating Rating Rating Rating Rating 
Views: 3117105
violetta nuevas canciones (22/09/12)
Rating Rating Rating Rating Rating 
Views: 1049375
hola chicos miren el video nuevo y disfruten de la musica y no dejen de ver la serie de violetta y si algunos no se han enterado del studio ,el...
Primer encuentro de tomas y violeta --Violeta
Rating Rating Rating Rating Rating 
Views: 2743983
el encuentro romantico de violeta y tomas
Violetta Habla Si Puedes Letra
Rating Rating Rating Rating Rating 
Views: 4967071
violeta - canción te creo
Rating Rating Rating Rating Rating 
Views: 320594
Leonetta su historia: parte 21 (Violetta)
Rating Rating Rating Rating Rating 
Views: 1225218
Todos los derechos del contenido pertenecen a Disney Channel, Pol-ka Productions y TV Group Digital.
Violetta - Tienes Todo (VideoClip Oficial) HD full
Rating Rating Rating Rating Rating 
Views: 15226322
Violetta: Video Musical Te Creo
Rating Rating Rating Rating Rating 
Views: 50900986
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¿Has visto este momento musical de Violetta?...
Violetta Momento Musical - Ludmila y Maxi cantan ¨Ahí estaré"
Rating Rating Rating Rating Rating 
Views: 8583260
Sitio Oficial: http://www.disneylatino.com/disneychannel Siguenos en Twitter: https://twitter.com/#!/DisneyChannel58 ¡Haz click en "Suscribirse"...

Comments:

Author Diewin Michelena (1 year)
espectacular como escribes un aplauso para ti

Author FABIANFAFASULI (1 year)
vii

Author Rafael Rodrigues (1 year)
xd

Author Joan Albuixech (1 year)
violetta es la mejor

Author ANA arocha (1 year)
vaya mierda de violetta

Author Johnjaga Gonzalez (1 year)
PAJUDA

Author Rafael Benate (1 year)
Violetta do disney chanel é com 2 ts. e não são todas as canções de
Violetta. não é nem metade do primeiro cd.

Author Laury Angel Mejia Sanchez (1 year)
Deje de ver violeta cuando se fue Thomas y xk siempre ponen personajes
nuevos para hacer actuaciones especiales ( Y demasiados :/ )

Author lauramoreira128 (1 year)
Sfxdgsftsx

Author fr4ckinho009 (1 year)
es una mierda esta musica loko una garcha por esta musica de mierda no
puedo joder en el Operation7 x mi ermana ojala saken toda esta mierda de
musika y pongan mas de reggaeton la concha de su madre

Author Sofia beltran (1 year)
valntina dejame un mensaje si estas aqui

Author taisaconceicao (1 year)
Adorooo violetaaa!!

Author Aguss Lc (1 year)
bf g

Author la fabyy (1 year)
altaaaaaaaaaaaaaaaaaaa

Author Mariana Viseu (1 year)
amo esta musica & a Violleta

Author Fernando López (1 year)
me encanta violetta haaaaaaaaaaaaaaaaaaaaaaa

Author Rubi ruiz gonzales (1 year)
achorado

Author maria teresa jimenez (1 year)
que calor en republica dominicana

Author henry franco (1 year)
Guauuu es icreible

Author Muerte AKD (1 year)
no me gusta tanto

Author Kamilly Victoria (1 year)
adorooooooooo so a musica ta srsrrs

Author Daniela Galeano Naranjo (1 year)
me gustan las canciones de violeta buenisimasssssssssssssssss

Author laufranco833 (1 year)
Mmm viole qedate cn thomas sn linda pareja 100pre u.p.s lumi ws cn leon sn
lindas pareja x malo xq ahora leon guau cambio malo como siempre marti ss
ws violetta

Author Arturo Reyna (1 year)
Amo a violetta

Author Rebeca Alarcón (1 year)
esas no son todas este video es un fraude

Author Joselin Infante (1 year)
Amo a violeta soy fan y qe se qede con leon

Author deborazagaglia (1 year)
Viole. Veni

Author Fernanda (1 year)
violeta apolla lal 3B de las carmelitas

Author rafael pizarro (1 year)
amo a vilu

Author Mónica Mamani Achá (1 year)
ME GUSTAN TODAJ EJTAJ CANCIONE "I LIKE"

Author jossicsa flores delgado (1 year)
violeta*4#&&-%"4/&3

Author jcarla927 (1 year)
ludmila patricinha

Author Anne Kerolayne (1 year)
es fantasticas las musicas de violetta

Author antoniapg25 (1 year)
Que bkn esta musica super

Author Olivia g uillen (1 year)
es bacan

Author carminakatia (1 year)
Violetta edes mi fam numero 1 adios

Author VICTORIA CRISTINA POBLETE DELIS (1 year)
jijhhu

Author martin epul (1 year)
!!!!PURO playback ¡¡¡¡

Author fernanda rosas (1 year)
Me encantan sus canciones

Author roberto molinero (1 year)
me encantan estas canciones son mis preferidas

Author lychi1105 (1 year)
Es presiosa Martina

Author maribelroja1971 (1 year)
Fue robar GHz dirección

Author elclubdelliceo (1 year)
son buenisimas

Author javi19375 (1 year)
guuuuuuuaaaaaauuuuuuu queeeee muuuuusiiiiicooooooneeeeeessssss

Author VICTORIA CRISTINA POBLETE DELIS (1 year)
ttr

Author rsolange50014 (1 year)
Me gusta violetta me encanta Si Violeta lee esto me pongo feliz

Author jrodriguezf475 (1 year)
Muy buen eno

Author estrellita257944 (1 year)
Kk

Author tiburciaargi (1 year)
Me gusta la segunda cancion, :)

Author andrea jimenez gonzalez (1 year)
Si las canciones de violeta son preciosas

Embed Video:

URL 
Link 

Search Video

Top Videos

Top 100 >>>

Videos

Check PR