Videos


todas las canciones de violeta



Rating Rating Rating Rating Rating 
Views: 2,006,360
Added: 1 year
Runtime: 14:59
Comments: 560

Tags for this video:  



Find more videos in the: "People"
Uploaded by: micaela gatu
See more videos uploaded by micaela gatu


Related Videos:

Violetta 2: Diego e Vilu cantano "Yo soy asi" - (Episodio 20)
Rating Rating Rating Rating Rating 
Views: 42500875
Violetta - Seconda Stagione - Disney Channel - Martina Stoessel - Diego Dominguez Facebook: https://www.facebook.com/DisneyMundialVioletta All...
Violetta Juntos Somos Mas (Letra-Testo-Lyrics in The Description)
Rating Rating Rating Rating Rating 
Views: 5048945
LUDMILLA: Quien le pone limite al deseo Cuando se quiere triunfar No importa nada lo que quiero Es cantar y bailar La diferencia esta aqui dentro...
Violetta Habla si Puedes (Ardilla)
Rating Rating Rating Rating Rating 
Views: 1875717
Frozen: Una Aventura Congelada - Libre Soy - Martina Stoessel
Rating Rating Rating Rating Rating 
Views: 58591046
Síguenos en Facebook: http://www.facebook.com/peliculasdisney Sitio Oficial: http://www.disneylatino.com/peliculas ¡Haz click en "Suscribirse"...
Violetta - Momento Musical: Violetta canta en el Restó Band
Rating Rating Rating Rating Rating 
Views: 3864747
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Síguenos en Facebook:...
Violetta: Dance Along de Juntos somos más - ¡Aprende la coreografía!
Rating Rating Rating Rating Rating 
Views: 7537843
¡Aprende a bailar con el elenco de Violetta! ¡Sigue el paso a paso, y divértete bailando! Mira más videos exclusivos de Violetta...
Violetta: Video Musical ¨Si Es Por Amor¨
Rating Rating Rating Rating Rating 
Views: 38477419
Sitio oficial: http://www.disneylatino.com/disneychannel/ Síguenos en Facebook: http://www.facebook.com/disneychannellatinoamerica ¡Haz click en...
Violetta: Peligrosamente Bellas (Episodio 40 - Temporada 2)
Rating Rating Rating Rating Rating 
Views: 19383068
Sitio oficial: http://www.disneylatino.com/disneychannel/ Síguenos en Facebook: http://www.facebook.com/disneychannellatinoamerica ¡Haz click en...
Violetta: Video musical Junto a ti
Rating Rating Rating Rating Rating 
Views: 36701680
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Síguenos en Facebook:...
Violetta: On Beat (Episodio 40 - Temporada 2)
Rating Rating Rating Rating Rating 
Views: 22453978
Sitio oficial: http://www.disneylatino.com/disneychannel/ Síguenos en Facebook: http://www.facebook.com/disneychannellatinoamerica ¡Haz click en...
Violetta: Vilu canta ¨Cómo Quieres¨ (Temp 2 Ep 41)
Rating Rating Rating Rating Rating 
Views: 5804317
Sitio oficial: http://www.disneylatino.com/disneychannel/ Síguenos en Facebook: http://www.facebook.com/disneychannellatinoamerica ¡Haz click en...
Violetta: Video Musical Hoy somos más (Nueva Temporada)
Rating Rating Rating Rating Rating 
Views: 54179757
Disney Channel estrena en exclusiva el video clip de Hoy Somos Más, el primer corte de difusión de la esperada nueva temporada de Violetta, que...
Violetta: Video Musical Te Creo
Rating Rating Rating Rating Rating 
Views: 42912313
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Síguenos en Facebook:...
Violetta: Video musical Ven y canta
Rating Rating Rating Rating Rating 
Views: 27991970
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Síguenos en Facebook:...
Rosita Fresita aventuras en tutti frutti parte 4 - 5 HD
Rating Rating Rating Rating Rating
Views: 13026230
Los pequeños pueden disfrutar de Rosita Fresita: Aventuras en Tutti Frutti. El clásico personaje animado vuelve a la pantalla renovada y demuestra,...
Los chicos le cantan a Violetta una cancion de despedida
Rating Rating Rating Rating Rating 
Views: 2296998
Violetta - Momento musical: ¨Algo suena en mi¨ en la fiesta de disfraces
Rating Rating Rating Rating Rating 
Views: 15155326
¡Disfruta de este clip del episodio 47 de Violetta! Mira más videos exclusivos de Violetta en...
Violeta - Juntos Somos Mas ( Letra ) ( Video Oficial ) ( HD )
Rating Rating Rating Rating Rating 
Views: 4777017
Hola chicos este es el video oficial de la cancion juntos somos mas de la nueva serie violeta mas la letra en el video disfrutenlo y suscribanse :)
Primer encuentro de tomas y violeta --Violeta
Rating Rating Rating Rating Rating 
Views: 2273547
el encuentro romantico de violeta y tomas
Violetta: Momento musical - Show final: Violetta canta con las chicas
Rating Rating Rating Rating Rating 
Views: 13964023
No te pierdas este clip del episodio 80 de Violetta. Mira más videos exclusivos de Violetta en...
Violetta Momento Musical - Ludmila y Maxi cantan ¨Ahí estaré"
Rating Rating Rating Rating Rating 
Views: 8240112
Sitio Oficial: http://www.disneylatino.com/disneychannel Siguenos en Twitter: https://twitter.com/#!/DisneyChannel58 ¡Haz click en "Suscribirse"...
Martina Stoessel (Violetta) a L'Anno Che Verrà: Ser Mejor e Libre Soy [HD]
Rating Rating Rating Rating Rating 
Views: 1601317
Seguitemi su Twitter: https://twitter.com/ChemyBeber
Violetta - Momento musical: Los chicos bailan ¨Tienes el talento¨
Rating Rating Rating Rating Rating 
Views: 4930458
No te pierdas este clip musical del episodio 63 de Violetta. Mira más videos exclusivos de Violetta en...
Violetta te esperare letra
Rating Rating Rating Rating Rating 
Views: 9155409
Ya tengo Twitter♥ https://twitter.com/rulaa2008 Hay sabrán Todo sobre el canal ;* Hola,No por que no la cante violetta no significa que pueden...
Violetta: Tomas e Vilu cantano Voy Por Ti (Ep33)
Rating Rating Rating Rating Rating 
Views: 10194831
Vilu y Tomas: Voy por ti Follow me on Twitter: https://twitter.com/Moni_Monster

Comments:

Author NELIDA BONGGI (4 months)
love

Author Ana Mita (5 months)
aaaaaaaaaaaaaaaa super

Author Kleber Torres (4 months)
linda violeta com leon

Author Cristina Montani (7 months)
valentina amondarain montani

Author Gime Tinista (6 months)
tini te adoro

Author Gime Tinista (6 months)
tini tini

Author Diewin Michelena (1 year)
espectacular como escribes un aplauso para ti

Author FABIANFAFASULI (1 year)
vii

Author Rafael Rodrigues (9 months)
xd

Author Joan Albuixech (1 year)
violetta es la mejor

Author ANA arocha (11 months)
vaya mierda de violetta

Author Johnjaga Gonzalez (1 year)
PAJUDA

Author Rafael Benate (1 year)
Violetta do disney chanel é com 2 ts. e não são todas as canções de
Violetta. não é nem metade do primeiro cd.

Author Laury Angel Mejia Sanchez (11 months)
Deje de ver violeta cuando se fue Thomas y xk siempre ponen personajes
nuevos para hacer actuaciones especiales ( Y demasiados :/ )

Author lauramoreira128 (1 year)
Sfxdgsftsx

Author fr4ckinho009 (1 year)
es una mierda esta musica loko una garcha por esta musica de mierda no
puedo joder en el Operation7 x mi ermana ojala saken toda esta mierda de
musika y pongan mas de reggaeton la concha de su madre

Author Sofia beltran (10 months)
valntina dejame un mensaje si estas aqui

Author taisaconceicao (1 year)
Adorooo violetaaa!!

Author Aguss Lc (1 year)
bf g

Author la fabyy Guachoona (1 year)
altaaaaaaaaaaaaaaaaaaa

Author Mariana Viseu (9 months)
amo esta musica & a Violleta

Author Fernando López (1 year)
me encanta violetta haaaaaaaaaaaaaaaaaaaaaaa

Author Rubi ruiz gonzales (1 year)
achorado

Author maria teresa jimenez (1 year)
que calor en republica dominicana

Author henry franco (1 year)
Guauuu es icreible

Author Muerte AKD (1 year)
no me gusta tanto

Author Kamilly Victoria (1 year)
adorooooooooo so a musica ta srsrrs

Author Daniela Galeano Naranjo (1 year)
me gustan las canciones de violeta buenisimasssssssssssssssss

Author laufranco833 (1 year)
Mmm viole qedate cn thomas sn linda pareja 100pre u.p.s lumi ws cn leon sn
lindas pareja x malo xq ahora leon guau cambio malo como siempre marti ss
ws violetta

Author Arturo Reyna (11 months)
Amo a violetta

Author Rebeca Alarcón (1 year)
esas no son todas este video es un fraude

Author Joselin Infante (1 year)
Amo a violeta soy fan y qe se qede con leon

Author deborazagaglia (1 year)
Viole. Veni

Author Fernanda (1 year)
violeta apolla lal 3B de las carmelitas

Author rafael pizarro (11 months)
amo a vilu

Author Mónica Mamani Achá (1 year)
ME GUSTAN TODAJ EJTAJ CANCIONE "I LIKE"

Author jossicsa flores delgado (11 months)
violeta*4#&&-%"4/&3

Author jcarla927 (1 year)
ludmila patricinha

Author Anne Kerolayne (1 year)
es fantasticas las musicas de violetta

Author antoniapg25 (1 year)
Que bkn esta musica super

Author Olivia g uillen (1 year)
es bacan

Author carminakatia (1 year)
Violetta edes mi fam numero 1 adios

Author VICTORIA CRISTINA POBLETE DELIS (1 year)
jijhhu

Author martin epul (10 months)
!!!!PURO playback ¡¡¡¡

Author fernanda rosas (11 months)
Me encantan sus canciones

Author roberto molinero (1 year)
me encantan estas canciones son mis preferidas

Author lychi1105 (11 months)
Es presiosa Martina

Author maribelroja1971 (1 year)
Fue robar GHz dirección

Author elclubdelliceo (1 year)
son buenisimas

Author javi19375 (1 year)
guuuuuuuaaaaaauuuuuuu queeeee muuuuusiiiiicooooooneeeeeessssss

Embed Video:

URL 
Link 

Search Video

Top Videos

Top 100 >>>

Videos

Check PR