Videos


todas las canciones de violeta



Rating Rating Rating Rating Rating 
Views: 2,062,960
Added: 2 years
Runtime: 14:59
Comments: 566

Tags for this video:  



Find more videos in the: "People"
Uploaded by: Jafiso Juegos y mas!
See more videos uploaded by Jafiso Juegos y mas!


Related Videos:

CD completo Violetta-primeiro e segundo CD
Rating Rating Rating Rating Rating 
Views: 5852817
Todas as músicas da 1° e 2° parte de violetta!! Facebook:http://www.facebook.com/maik.silva159?ref=tn_tnmn...
Violetta: Peligrosamente Bellas (Episodio 40 - Temporada 2)
Rating Rating Rating Rating Rating 
Views: 24016641
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Esta canción seguramente está entre tus...
Violetta: Video Musical Hoy somos más (Nueva Temporada)
Rating Rating Rating Rating Rating 
Views: 61798397
Descubre más en el sitio: http://www.disneylatino.com/violetta Canta con Violetta y seguí la letra de ¨Hoy somos más¨: Valió la pena todo hasta...
Violetta: Video musical Junto a ti
Rating Rating Rating Rating Rating 
Views: 42311324
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Canta y baila esta canción de Violetta!...
Violetta: Video Musical ¨Si Es Por Amor¨
Rating Rating Rating Rating Rating 
Views: 46780529
Mira más videos exclusivos de Violetta en: http://disneychannel.disneylatino.com/violetta ¿Has visto este momento musical de Violetta? Te...
Violetta: Dance Along de Juntos somos más - ¡Aprende la coreografía!
Rating Rating Rating Rating Rating 
Views: 8118897
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Aprende a bailar con el elenco de Violetta!...
Frozen: Una Aventura Congelada - Libre Soy - Martina Stoessel
Rating Rating Rating Rating Rating 
Views: 73318856
Síguenos en Facebook: http://www.facebook.com/peliculasdisney Sitio Oficial: http://www.disneylatino.com/peliculas ¡Haz click en "Suscribirse"...
Violetta en Vivo: Venezuela
Rating Rating Rating Rating Rating 
Views: 2215860
Violetta en Vivo: Venezuela
violetta vs grachi ¿quien es mejor?
Rating Rating Rating Rating Rating 
Views: 1240138
es mejor violetta
Violetta 2: Diego e Vilu cantano "Yo soy asi" - (Episodio 20)
Rating Rating Rating Rating Rating 
Views: 49618572
Violetta - Seconda Stagione - Disney Channel - Martina Stoessel - Diego Dominguez Facebook: https://www.facebook.com/DisneyMundialVioletta All...
Violetta: Momento Musical - Violetta canta en el Restó Band
Rating Rating Rating Rating Rating 
Views: 4353313
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Canta y baila esta canción de Violetta!...
Violetta CD - Preview + Download On ITunes
Rating Rating Rating Rating Rating 
Views: 2447713
Vote , Watch and Subscribe ;) Buy On Itunes : http://itunes.apple.com/ar/album/violetta/id530338460
Violetta Habla si Puedes (Ardilla)
Rating Rating Rating Rating Rating 
Views: 2049634
Violeta - Juntos Somos Mas ( Letra ) ( Video Oficial ) ( HD )
Rating Rating Rating Rating Rating 
Views: 4858553
Hola chicos este es el video oficial de la cancion juntos somos mas de la nueva serie violeta mas la letra en el video disfrutenlo y suscribanse :)
Violetta: Video Musical Te Creo
Rating Rating Rating Rating Rating 
Views: 49153443
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¿Has visto este momento musical de Violetta?...
Violetta-Canciones Parte 1
Rating Rating Rating Rating Rating 
Views: 458261
Canciones (banda sonora de Violetta) PARTE 2- http://www.youtube.com/watch?v=6yU8J9-NXXI&feature=youtu.be PARTE 3-...
Violetta: Momento musical - Show final: Violetta canta con las chicas
Rating Rating Rating Rating Rating 
Views: 16454435
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ No te pierdas este clip del episodio 80 de...
Violetta: Vilu canta ¨Cómo Quieres¨ (Temp 2 Ep 41)
Rating Rating Rating Rating Rating 
Views: 7966818
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Canta y baila esta canción de Violetta!...
014 SORPRESA ¿Violetta tiene una hermana, Jueves 27 de Marzo del 2014 Violetta ARGENTINA
Rating Rating Rating Rating Rating 
Views: 2449159
Violetta Momento Musical - Ludmila y Maxi cantan ¨Ahí estaré"
Rating Rating Rating Rating Rating 
Views: 8484042
Sitio Oficial: http://www.disneylatino.com/disneychannel Siguenos en Twitter: https://twitter.com/#!/DisneyChannel58 ¡Haz click en "Suscribirse"...
Violetta Show final Violetta y elenco cantan 'Ser Mejor'
Rating Rating Rating Rating Rating 
Views: 12351014
gracias por el 1.000.000 de reproducciones! ;)
Violetta: Tomas e Vilu cantano Voy Por Ti (Ep33)
Rating Rating Rating Rating Rating 
Views: 10813854
Vilu y Tomas: Voy por ti Follow me on Twitter: https://twitter.com/Moni_Monster
Voy Por Ti - Leon - Violetta (Letra) Cancion Completa
Rating Rating Rating Rating Rating 
Views: 3074511
Violetta: On Beat (Episodio 40 - Temporada 2)
Rating Rating Rating Rating Rating 
Views: 26701008
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Si eres fan de las canciones de Violetta, no...
Violetta en Vivo: Empieza el show en México
Rating Rating Rating Rating Rating 
Views: 1055082
Disfruta viendo al elenco de Violetta antes de salir al primer show en el Auditorio Nacional de México. Sitio oficial:...

Comments:

Author Diewin Michelena (1 year)
espectacular como escribes un aplauso para ti

Author FABIANFAFASULI (1 year)
vii

Author Rafael Rodrigues (1 year)
xd

Author Joan Albuixech (1 year)
violetta es la mejor

Author ANA arocha (1 year)
vaya mierda de violetta

Author Johnjaga Gonzalez (1 year)
PAJUDA

Author Rafael Benate (1 year)
Violetta do disney chanel é com 2 ts. e não são todas as canções de
Violetta. não é nem metade do primeiro cd.

Author Laury Angel Mejia Sanchez (1 year)
Deje de ver violeta cuando se fue Thomas y xk siempre ponen personajes
nuevos para hacer actuaciones especiales ( Y demasiados :/ )

Author lauramoreira128 (1 year)
Sfxdgsftsx

Author fr4ckinho009 (1 year)
es una mierda esta musica loko una garcha por esta musica de mierda no
puedo joder en el Operation7 x mi ermana ojala saken toda esta mierda de
musika y pongan mas de reggaeton la concha de su madre

Author Sofia beltran (1 year)
valntina dejame un mensaje si estas aqui

Author taisaconceicao (1 year)
Adorooo violetaaa!!

Author Aguss Lc (1 year)
bf g

Author la fabyy (1 year)
altaaaaaaaaaaaaaaaaaaa

Author Mariana Viseu (1 year)
amo esta musica & a Violleta

Author Fernando López (1 year)
me encanta violetta haaaaaaaaaaaaaaaaaaaaaaa

Author Rubi ruiz gonzales (1 year)
achorado

Author maria teresa jimenez (1 year)
que calor en republica dominicana

Author henry franco (1 year)
Guauuu es icreible

Author Muerte AKD (1 year)
no me gusta tanto

Author Kamilly Victoria (1 year)
adorooooooooo so a musica ta srsrrs

Author Daniela Galeano Naranjo (1 year)
me gustan las canciones de violeta buenisimasssssssssssssssss

Author laufranco833 (1 year)
Mmm viole qedate cn thomas sn linda pareja 100pre u.p.s lumi ws cn leon sn
lindas pareja x malo xq ahora leon guau cambio malo como siempre marti ss
ws violetta

Author Arturo Reyna (1 year)
Amo a violetta

Author Rebeca Alarcón (1 year)
esas no son todas este video es un fraude

Author Joselin Infante (1 year)
Amo a violeta soy fan y qe se qede con leon

Author deborazagaglia (1 year)
Viole. Veni

Author Fernanda (1 year)
violeta apolla lal 3B de las carmelitas

Author rafael pizarro (1 year)
amo a vilu

Author Mónica Mamani Achá (1 year)
ME GUSTAN TODAJ EJTAJ CANCIONE "I LIKE"

Author jossicsa flores delgado (1 year)
violeta*4#&&-%"4/&3

Author jcarla927 (1 year)
ludmila patricinha

Author Anne Kerolayne (1 year)
es fantasticas las musicas de violetta

Author antoniapg25 (1 year)
Que bkn esta musica super

Author Olivia g uillen (1 year)
es bacan

Author carminakatia (1 year)
Violetta edes mi fam numero 1 adios

Author VICTORIA CRISTINA POBLETE DELIS (1 year)
jijhhu

Author martin epul (1 year)
!!!!PURO playback ¡¡¡¡

Author fernanda rosas (1 year)
Me encantan sus canciones

Author roberto molinero (1 year)
me encantan estas canciones son mis preferidas

Author lychi1105 (1 year)
Es presiosa Martina

Author maribelroja1971 (1 year)
Fue robar GHz dirección

Author elclubdelliceo (1 year)
son buenisimas

Author javi19375 (1 year)
guuuuuuuaaaaaauuuuuuu queeeee muuuuusiiiiicooooooneeeeeessssss

Author VICTORIA CRISTINA POBLETE DELIS (1 year)
ttr

Author rsolange50014 (1 year)
Me gusta violetta me encanta Si Violeta lee esto me pongo feliz

Author jrodriguezf475 (1 year)
Muy buen eno

Author estrellita257944 (1 year)
Kk

Author tiburciaargi (1 year)
Me gusta la segunda cancion, :)

Author andrea jimenez gonzalez (1 year)
Si las canciones de violeta son preciosas

Embed Video:

URL 
Link 

Search Video

Top Videos

Top 100 >>>

Videos

Check PR