Videos


todas las canciones de violeta



Rating Rating Rating Rating Rating 
Views: 2,089,534
Added: 2 years
Runtime: 14:59
Comments: 460

Tags for this video:  



Find more videos in the: "People"
Uploaded by: Juego Juegos y más
See more videos uploaded by Juego Juegos y más


Related Videos:

Violetta: Momento musical - Show final: Violetta canta con las chicas
Rating Rating Rating Rating Rating 
Views: 19161764
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ No te pierdas este clip del episodio 80 de...
Violetta Habla si Puedes (Ardilla)
Rating Rating Rating Rating Rating 
Views: 2127658
Frozen: Una Aventura Congelada - Libre Soy - Martina Stoessel
Rating Rating Rating Rating Rating 
Views: 81972227
Síguenos en Facebook: http://www.facebook.com/peliculasdisney Sitio Oficial: http://www.disneylatino.com/peliculas ¡Haz click en "Suscribirse"...
Barbie Life in the Dreamhouse - Temporada 6 [Completa]
Rating Rating Rating Rating Rating 
Views: 8802934
Barbie Life in the Dreamhouse | Temporada 6 Lista de los capítulos: Súper Escuadrón del Estilo Parte 1 Súper Escuadrón del Estilo Parte 2 Vestido...
Violetta: Vilu canta ¨Cómo Quieres¨ (Temp 2 Ep 41)
Rating Rating Rating Rating Rating 
Views: 9277178
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Canta y baila esta canción de Violetta!...
Violetta 2: Diego e Vilu cantano "Yo soy asi" - (Episodio 20)
Rating Rating Rating Rating Rating 
Views: 53741280
Violetta - Seconda Stagione - Disney Channel - Martina Stoessel - Diego Dominguez Facebook: https://www.facebook.com/DisneyMundialVioletta All...
Violetta: Video Musical ¨Si Es Por Amor¨
Rating Rating Rating Rating Rating 
Views: 51939180
Mira más videos exclusivos de Violetta en: http://disneychannel.disneylatino.com/violetta ¿Has visto este momento musical de Violetta? Te...
Violeta - Juntos Somos Mas ( Letra ) ( Video Oficial ) ( HD )
Rating Rating Rating Rating Rating 
Views: 4884827
Hola chicos este es el video oficial de la cancion juntos somos mas de la nueva serie violeta mas la letra en el video disfrutenlo y suscribanse :)
Violetta: Peligrosamente Bellas (Episodio 40 - Temporada 2)
Rating Rating Rating Rating Rating 
Views: 26994390
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Esta canción seguramente está entre tus...
Violetta: Momento Musical - Violetta canta en el Restó Band
Rating Rating Rating Rating Rating 
Views: 4731655
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Canta y baila esta canción de Violetta!...
Violetta: Video Musical Hoy somos más
Rating Rating Rating Rating Rating 
Views: 65305897
Descubre más en el sitio: http://www.disneylatino.com/violetta Canta con Violetta y seguí la letra de ¨Hoy somos más¨: Valió la pena todo hasta...
Leonetta su historia: parte 21 (Violetta)
Rating Rating Rating Rating Rating 
Views: 1289419
Todos los derechos del contenido pertenecen a Disney Channel, Pol-ka Productions y TV Group Digital.
Violetta: Tomas e Vilu cantano Voy Por Ti (Ep33)
Rating Rating Rating Rating Rating 
Views: 11179415
Vilu y Tomas: Voy por ti Follow me on Twitter: https://twitter.com/Moni_Monster
014 SORPRESA ¿Violetta tiene una hermana, Jueves 27 de Marzo del 2014 Violetta ARGENTINA
Rating Rating Rating Rating Rating 
Views: 3559136
Violetta Momento Musical - Ludmila y Maxi cantan ¨Ahí estaré"
Rating Rating Rating Rating Rating 
Views: 8667752
Sitio Oficial: http://www.disneylatino.com/disneychannel Siguenos en Twitter: https://twitter.com/#!/DisneyChannel58 ¡Haz click en "Suscribirse"...
Violetta: Dance Along de Juntos somos más - ¡Aprende la coreografía!
Rating Rating Rating Rating Rating 
Views: 8446933
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Aprende a bailar con el elenco de Violetta!...
TODO EL ELENCO DE MISS XV BFF
Rating Rating Rating Rating Rating 
Views: 2279007
veanlo!
Los chicos le cantan a Violetta una cancion de despedida
Rating Rating Rating Rating Rating 
Views: 2429978
Primer encuentro de tomas y violeta --Violeta
Rating Rating Rating Rating Rating 
Views: 2816129
el encuentro romantico de violeta y tomas
Rosita Fresita aventuras en tutti frutti parte 4 - 5 HD
Rating Rating Rating Rating Rating
Views: 14546396
Los pequeños pueden disfrutar de Rosita Fresita: Aventuras en Tutti Frutti. El clásico personaje animado vuelve a la pantalla renovada y demuestra,...
Violetta: Video musical Junto a ti
Rating Rating Rating Rating Rating 
Views: 45602773
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Canta y baila esta canción de Violetta!...
Violetta: On Beat (Episodio 40 - Temporada 2)
Rating Rating Rating Rating Rating 
Views: 29060804
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Si eres fan de las canciones de Violetta, no...
Violetta: Video Musical Te Creo
Rating Rating Rating Rating Rating 
Views: 52289903
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¿Has visto este momento musical de Violetta?...
Violetta-Te Creo (Chipettes version)
Rating Rating Rating Rating Rating 
Views: 1022284
TE CREOOO!!!!! TE CREOOO!!!!!
Violetta: Momento musical - ¨Algo suena en mi¨ en la fiesta de disfraces
Rating Rating Rating Rating Rating 
Views: 17845156
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ ¡Disfruta de este clip del episodio 47 de...

Comments:

Author Dennis medina peralta (1 year)
me gusta todos tu canciones viopeta

Author Diewin Michelena (1 year)
espectacular como escribes un aplauso para ti

Author FABIANFAFASULI (1 year)
vii

Author Rafael Rodrigues (1 year)
xd

Author Joan Albuixech (1 year)
violetta es la mejor

Author ximena parra (1 year)
violeta eres la mego te amooooooooooooo
besoooooooooooooooooooooooooooooooooooooooooooooooooooo

Author ANA arocha (1 year)
vaya mierda de violetta

Author Johnjaga Gonzalez (1 year)
PAJUDA

Author Rafael Benate (1 year)
Violetta do disney chanel é com 2 ts. e não são todas as canções de
Violetta. não é nem metade do primeiro cd.

Author Laury Angel Mejia Sanchez (1 year)
Deje de ver violeta cuando se fue Thomas y xk siempre ponen personajes
nuevos para hacer actuaciones especiales ( Y demasiados :/ )

Author yelibeth rodriguez (1 year)
en cuentro todo en mi musica

Author nancy sarmiento (1 year)
haaaaaa!!!! son los maximo todos siiiii me re encanta

Author lauramoreira128 (1 year)
Sfxdgsftsx

Author Sofia beltran (1 year)
valntina dejame un mensaje si estas aqui

Author taisaconceicao (1 year)
Adorooo violetaaa!!

Author Aguss Lc (1 year)
bf g

Author la fabyy (1 year)
altaaaaaaaaaaaaaaaaaaa

Author Mariana Viseu (1 year)
amo esta musica & a Violleta

Author Fernando López (1 year)
me encanta violetta haaaaaaaaaaaaaaaaaaaaaaa

Author amateratsu646 (1 year)
algun hombre a comentado

Author Rubi ruiz gonzales (1 year)
achorado

Author maria teresa jimenez (1 year)
que calor en republica dominicana

Author daniel rufach (1 year)
este video de violeta estya
culquisimoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo
jajajajajajajajajajajajajajajajaja.soy luciana jajajajajajajajajaja de la
mjuan arseno

Author henry franco (1 year)
Guauuu es icreible

Author Muerte AKD (1 year)
no me gusta tanto

Author Kamilly Victoria (1 year)
adorooooooooo so a musica ta srsrrs

Author Daniela Galeano Naranjo (1 year)
me gustan las canciones de violeta buenisimasssssssssssssssss

Author Arturo Reyna (1 year)
Amo a violetta

Author Rebeca Alarcón (1 year)
esas no son todas este video es un fraude

Author Joselin Infante (1 year)
Amo a violeta soy fan y qe se qede con leon

Author Fernanda (1 year)
violeta apolla lal 3B de las carmelitas

Author rafael pizarro (1 year)
amo a vilu

Author Mónica Mamani Achá (1 year)
ME GUSTAN TODAJ EJTAJ CANCIONE "I LIKE"

Author Lara gemelier16# (1 year)
como molan las canciones de violeta hola a todos

Author jossicsa flores delgado (1 year)
violeta*4#&&-%"4/&3

Author jcarla927 (1 year)
ludmila patricinha

Author Anne Kerolayne (1 year)
es fantasticas las musicas de violetta

Author Olivia g uillen (1 year)
es bacan

Author VICTORIA CRISTINA POBLETE DELIS (1 year)
jijhhu

Author martin epul (1 year)
!!!!PURO playback ¡¡¡¡

Author fernanda rosas (1 year)
Me encantan sus canciones

Author roberto molinero (1 year)
me encantan estas canciones son mis preferidas

Author lychi1105 (1 year)
Es presiosa Martina

Author memurrio22 (1 year)
jaja. ta bueno

Author elclubdelliceo (1 year)
son buenisimas

Author javi19375 (1 year)
guuuuuuuaaaaaauuuuuuu queeeee muuuuusiiiiicooooooneeeeeessssss

Author VICTORIA CRISTINA POBLETE DELIS (1 year)
ttr

Author jrodriguezf475 (1 year)
Muy buen eno

Author estrellita257944 (1 year)
Kk

Author andrea jimenez gonzalez (1 year)
Si las canciones de violeta son preciosas

Embed Video:

URL 
Link 

Search Video

Top Videos

Top 100 >>>

Videos

Check PR