Videos


todas las canciones de violeta



Rating Rating Rating Rating Rating 
Views: 2,022,707
Added: 1 year
Runtime: 14:59
Comments: 560

Tags for this video:  



Find more videos in the: "People"
Uploaded by: micaela gatu
See more videos uploaded by micaela gatu


Related Videos:

Violetta Juntos Somos Mas (Letra-Testo-Lyrics in The Description)
Rating Rating Rating Rating Rating 
Views: 5171449
LUDMILLA: Quien le pone limite al deseo Cuando se quiere triunfar No importa nada lo que quiero Es cantar y bailar La diferencia esta aqui dentro...
Frozen: Una Aventura Congelada - Libre Soy - Martina Stoessel
Rating Rating Rating Rating Rating 
Views: 62021286
Síguenos en Facebook: http://www.facebook.com/peliculasdisney Sitio Oficial: http://www.disneylatino.com/peliculas ¡Haz click en "Suscribirse"...
Violetta 2: Diego e Vilu cantano "Yo soy asi" - (Episodio 20)
Rating Rating Rating Rating Rating 
Views: 44027620
Violetta - Seconda Stagione - Disney Channel - Martina Stoessel - Diego Dominguez Facebook: https://www.facebook.com/DisneyMundialVioletta All...
Violetta - Momento Musical: Violetta canta en el Restó Band
Rating Rating Rating Rating Rating 
Views: 3966436
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Síguenos en Facebook:...
Violetta: Video Musical ¨Si Es Por Amor¨
Rating Rating Rating Rating Rating 
Views: 40103816
Sitio oficial: http://www.disneylatino.com/disneychannel/ Síguenos en Facebook: http://www.facebook.com/disneychannellatinoamerica ¡Haz click en...
Violetta: Peligrosamente Bellas (Episodio 40 - Temporada 2)
Rating Rating Rating Rating Rating 
Views: 20290766
Sitio oficial: http://www.disneylatino.com/disneychannel/ Síguenos en Facebook: http://www.facebook.com/disneychannellatinoamerica ¡Haz click en...
Violetta: Vilu canta ¨Cómo Quieres¨ (Temp 2 Ep 41)
Rating Rating Rating Rating Rating 
Views: 6218169
Sitio oficial: http://www.disneylatino.com/disneychannel/ Síguenos en Facebook: http://www.facebook.com/disneychannellatinoamerica ¡Haz click en...
Violetta Habla si Puedes (Ardilla)
Rating Rating Rating Rating Rating 
Views: 1922562
Violetta: Video Musical Hoy somos más (Nueva Temporada)
Rating Rating Rating Rating Rating 
Views: 55974335
Disney Channel estrena en exclusiva el video clip de Hoy Somos Más, el primer corte de difusión de la esperada nueva temporada de Violetta, que...
Violetta: Video musical Junto a ti
Rating Rating Rating Rating Rating 
Views: 37911828
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Síguenos en Facebook:...
Violetta: Dance Along de Juntos somos más - ¡Aprende la coreografía!
Rating Rating Rating Rating Rating 
Views: 7661739
¡Aprende a bailar con el elenco de Violetta! ¡Sigue el paso a paso, y divértete bailando! Mira más videos exclusivos de Violetta...
Violetta: Video musical Ven y canta
Rating Rating Rating Rating Rating 
Views: 29007210
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Síguenos en Facebook:...
Violetta-Te Creo (Chipettes version)
Rating Rating Rating Rating Rating 
Views: 939031
TE CREOOO!!!!! TE CREOOO!!!!!
Violetta: On Beat (Episodio 40 - Temporada 2)
Rating Rating Rating Rating Rating 
Views: 23382119
Sitio oficial: http://www.disneylatino.com/disneychannel/ Síguenos en Facebook: http://www.facebook.com/disneychannellatinoamerica ¡Haz click en...
Violetta: Momento musical - Show final: Violetta canta con las chicas
Rating Rating Rating Rating Rating 
Views: 14332060
No te pierdas este clip del episodio 80 de Violetta. Mira más videos exclusivos de Violetta en...
Violetta - Momento musical: ¨Algo suena en mi¨ en la fiesta de disfraces
Rating Rating Rating Rating Rating 
Views: 15498765
¡Disfruta de este clip del episodio 47 de Violetta! Mira más videos exclusivos de Violetta en...
Violetta: Video Musical Te Creo
Rating Rating Rating Rating Rating 
Views: 44417355
Mira más videos exclusivos de Violetta en http://www.disneylatino.com/disneychannel/series/violetta/ Síguenos en Facebook:...
Violetta: Duelo de Galanes - ¡A sacudirse!
Rating Rating Rating Rating Rating 
Views: 4579075
Jorge y Pablo se enfrentan en un baile un poco... agitado. Mira más videos exclusivos de Violetta en...
Violetta 3: Capítulo 1 - Completo
Rating Rating Rating Rating Rating 
Views: 1317558
Violetta - Terza Stagione - Disney Channel Facebook: https://www.facebook.com/DisneyMundialVioletta All rights go to Disney Channel America Latina...
Violetta: Tomas e Vilu cantano Voy Por Ti (Ep33)
Rating Rating Rating Rating Rating 
Views: 10337023
Vilu y Tomas: Voy por ti Follow me on Twitter: https://twitter.com/Moni_Monster
Primer encuentro de tomas y violeta --Violeta
Rating Rating Rating Rating Rating 
Views: 2372280
el encuentro romantico de violeta y tomas
Violetta en Vivo: Empieza el show en México
Rating Rating Rating Rating Rating 
Views: 946010
Disfruta viendo al elenco de Violetta antes de salir al primer show en el Auditorio Nacional de México. Sitio oficial:...
TODO EL ELENCO DE MISS XV BFF
Rating Rating Rating Rating Rating 
Views: 2256052
veanlo!
Rosita Fresita aventuras en tutti frutti parte 4 - 5 HD
Rating Rating Rating Rating Rating
Views: 13322186
Los pequeños pueden disfrutar de Rosita Fresita: Aventuras en Tutti Frutti. El clásico personaje animado vuelve a la pantalla renovada y demuestra,...
Violeta - Juntos Somos Mas ( Letra ) ( Video Oficial ) ( HD )
Rating Rating Rating Rating Rating 
Views: 4798478
Hola chicos este es el video oficial de la cancion juntos somos mas de la nueva serie violeta mas la letra en el video disfrutenlo y suscribanse :)

Comments:

Author Diewin Michelena (1 year)
espectacular como escribes un aplauso para ti

Author FABIANFAFASULI (1 year)
vii

Author Rafael Rodrigues (10 months)
xd

Author Joan Albuixech (1 year)
violetta es la mejor

Author ANA arocha (11 months)
vaya mierda de violetta

Author Johnjaga Gonzalez (1 year)
PAJUDA

Author Rafael Benate (1 year)
Violetta do disney chanel é com 2 ts. e não são todas as canções de
Violetta. não é nem metade do primeiro cd.

Author Laury Angel Mejia Sanchez (1 year)
Deje de ver violeta cuando se fue Thomas y xk siempre ponen personajes
nuevos para hacer actuaciones especiales ( Y demasiados :/ )

Author lauramoreira128 (1 year)
Sfxdgsftsx

Author fr4ckinho009 (1 year)
es una mierda esta musica loko una garcha por esta musica de mierda no
puedo joder en el Operation7 x mi ermana ojala saken toda esta mierda de
musika y pongan mas de reggaeton la concha de su madre

Author Sofia beltran (11 months)
valntina dejame un mensaje si estas aqui

Author taisaconceicao (1 year)
Adorooo violetaaa!!

Author Aguss Lc (1 year)
bf g

Author la fabyy Guachoona (1 year)
altaaaaaaaaaaaaaaaaaaa

Author Mariana Viseu (10 months)
amo esta musica & a Violleta

Author Fernando López (1 year)
me encanta violetta haaaaaaaaaaaaaaaaaaaaaaa

Author Rubi ruiz gonzales (1 year)
achorado

Author maria teresa jimenez (1 year)
que calor en republica dominicana

Author henry franco (1 year)
Guauuu es icreible

Author Muerte AKD (1 year)
no me gusta tanto

Author Kamilly Victoria (1 year)
adorooooooooo so a musica ta srsrrs

Author Daniela Galeano Naranjo (1 year)
me gustan las canciones de violeta buenisimasssssssssssssssss

Author laufranco833 (1 year)
Mmm viole qedate cn thomas sn linda pareja 100pre u.p.s lumi ws cn leon sn
lindas pareja x malo xq ahora leon guau cambio malo como siempre marti ss
ws violetta

Author Arturo Reyna (1 year)
Amo a violetta

Author Rebeca Alarcón (1 year)
esas no son todas este video es un fraude

Author Joselin Infante (1 year)
Amo a violeta soy fan y qe se qede con leon

Author deborazagaglia (1 year)
Viole. Veni

Author Fernanda (1 year)
violeta apolla lal 3B de las carmelitas

Author rafael pizarro (1 year)
amo a vilu

Author Mónica Mamani Achá (1 year)
ME GUSTAN TODAJ EJTAJ CANCIONE "I LIKE"

Author jossicsa flores delgado (11 months)
violeta*4#&&-%"4/&3

Author jcarla927 (1 year)
ludmila patricinha

Author Anne Kerolayne (1 year)
es fantasticas las musicas de violetta

Author antoniapg25 (1 year)
Que bkn esta musica super

Author Olivia g uillen (1 year)
es bacan

Author carminakatia (1 year)
Violetta edes mi fam numero 1 adios

Author VICTORIA CRISTINA POBLETE DELIS (1 year)
jijhhu

Author martin epul (10 months)
!!!!PURO playback ¡¡¡¡

Author fernanda rosas (1 year)
Me encantan sus canciones

Author roberto molinero (1 year)
me encantan estas canciones son mis preferidas

Author lychi1105 (11 months)
Es presiosa Martina

Author maribelroja1971 (1 year)
Fue robar GHz dirección

Author elclubdelliceo (1 year)
son buenisimas

Author javi19375 (1 year)
guuuuuuuaaaaaauuuuuuu queeeee muuuuusiiiiicooooooneeeeeessssss

Author VICTORIA CRISTINA POBLETE DELIS (1 year)
ttr

Author rsolange50014 (1 year)
Me gusta violetta me encanta Si Violeta lee esto me pongo feliz

Author jrodriguezf475 (1 year)
Muy buen eno

Author estrellita257944 (1 year)
Kk

Author tiburciaargi (1 year)
Me gusta la segunda cancion, :)

Author andrea jimenez gonzalez (1 year)
Si las canciones de violeta son preciosas

Embed Video:

URL 
Link 

Search Video

Top Videos

Top 100 >>>

Videos

Check PR